Software implementation of Spark.
Spark is a time- and space-efficient sparsified minimum free energy folding of possibly-pseudoknotted RNAs
Linux, macOS
Requirements: A compiler that supports C++11 standard (tested with g++ version 4.9.0 or higher), Pthreads, and CMake version 3.1 or greater.
CMake version 3.1 or greater must be installed in a way that HFold can find it.
To test if your Mac or Linux system already has CMake, you can type into a terminal:
cmake --version
If it does not print a cmake version greater than or equal to 3.1, you will have to install CMake depending on your operating system.
- Download the repository and extract the files onto your system.
- From a command line in the root directory (where this README.md is) run
cmake -H. -Bbuild
cmake --build build
If you need to specify a specific compiler, such as g++, you can instead run something like
cmake -H. -Bbuild -DCMAKE_CXX_COMPILER=g++
cmake --build build
This can be useful if you are getting errors about your compiler not having C++17 features.
Usage: Spark[options] [-r "input structure"] [input sequence]
Read input file from cmdline; predict minimum free energy and optimum structure using the time- and space-efficient MFE RNA folding algorithm.
-h, --help Print help and exit
-V, --version Print version and exit
-v, --verbose Turn on verbose output
-m, --mark-candidates Represent candidate base pairs by curly brackets
-r, --input-structure Give a restricted structure as an input structure (required for pseudoknots)
-i, --input-file Give a path to an input file containing the sequence (and input structure if known)
-p, --pseudoknot-free Turn off pseudoknot prediction
-k, --pk-only Only add base pairs which cross the constraint structure. The constraint structure is returned if there are no energetically favorable crossing base pairs
-d, --dangles=INT How to treat \"dangling end\" energies for bases adjacent to helices in free ends and multi-loops (default=`2')
-P, --paramFile Read energy parameters from paramfile, instead of using the default parameter set.
--noGC Turn off garbage collection and related overhead
--noGU Turn off Wobble base pairing
--noConv Do not convert DNA into RNA. This will use the Matthews 2004 parameters for DNA
Remarks: The default parameter file is DP09. This can be changed via -P and specifying the parameter file you would like
assume you are in the Spark directory
./build/Spark GGGGAAAACCCC
./build/Spark -d1 -r "((........))" GGGGAAAACCCC
./build/Spark -d1 -P "params/rna_Turner04.par" -r "((........))" GGGGAAAACCCC
./build/Spark -i input.txt
./build/Spark -m -v -r "...............(((((((...)))))))..................." UAACUUAGGGGUUAAAGUUGCAGAUUGUGGCUCUGAAAACACGGGUUCGAA
UAACUUAGGGGUUAAAGUUGCAGAUUGUGGCUCUGAAAACACGGGUUCGAA
{{{({....})}}}.((((((([[[)))))))............]]].... (-7.95)
TA cnt: 63
TA max: 63
TA av: 61
TA rm: 3
Can num: 47
Can cap: 52
TAs num: 63
TAs cap: 64
Psuedoknotted
TAs num: 1
TAs cap: 1
TA av: 5
TA rm: 0
WMB Can num: 6
WMB Can cap: 7
VP Can num: 25
VP Can cap: 25
BE Can num: 7
BE Can cap: 7
Results can be found at https://github.com/mateog4712/Spark-RawData
For questions, you can email mateo2@ualberta.ca