Skip to content

klashxx/awk

Repository files navigation

AWK

Examples from my practical Guide

A beginner's guide to the *nix swiss army knife

⚠️ Disclaimer ⚠️

This text refers only to awk's GNU implementation known as gawk witch is the most used one and comes with any modern Linux / Unix distribution.

[The GNU Awk User’s Guide][gnu-awk] is its reference, for the examples I used real world cases taken mainly from my [Stackoverflow][so] answers.


AWK is a language similar to PERL, only considerably more elegant.

  • Arnold Robbins

What ??

AWK is a programming language designed for text processing and typically used as a data extraction and reporting tool. It is a standard feature of most Unix-like operating systems.

awkaward name ...

its name is derived from the surnames of its authors – Alfred Aho, Peter Weinberger, and Brian Kernighan.

So awk ...

  • Searchs for lines that contain certain patterns in files or the standard input.

  • Mostly used for data extraction and reporting like summarizing information from the output of other utility programs.

  • C-like syntax.

  • Data Driven: it's describe the data you want to work with and then what action to do when you find it.

pattern { action }
pattern { action }

The Basics

How to Run it

If the program is short:

awk 'program' input-file1 input-file2

Note: Beware of shell quoting issues1.

cmd | awk 'program'

Note: The pipe redirects the output of the left-hand command (cmd) to the input of the awk command2.

When the code is long, it is usually more convenient to put it in a file and run it with a command like this:

awk -f program-file input-file1 input-file2

cmd | awk -f program-file

Or just make it executable like a shebang:

#!/bin/awk -f

BEGIN { print "hello world!!" }

Other useful flags

-F fs Set the FS variable to fs.

-v var=val Set the variable var to the value val before execution of the program begins.

👉 Note: it can be used more than once, setting another variable each time.

BEGIN and END

These special patterns or blocks supply startup and cleanup actions for awk programs.

BEGIN{
    // initialize variables
}
{
    /pattern/ { action }
}
END{
    // cleanup
}

⚠️ WARNING: Both rules are executed once only, BEGIN before the first input record is read, END after all the input is consumed.

$ echo "hello"| awk 'BEGIN{print "BEGIN";f=1}
                    {print $f}
                    END{print "END"}'
BEGIN
hello
END

Why grepping if you have awk ??

$ cat lorem_ipsum.dat
Lorem ipsum dolor sit amet, consectetur adipiscing elit.
Maecenas pellentesque erat vel tortor consectetur condimentum.
Nunc enim orci, euismod id nisi eget, interdum cursus ex.
Curabitur a dapibus tellus.
Lorem ipsum dolor sit amet, consectetur adipiscing elit.
Aliquam interdum mauris volutpat nisl placerat, et facilisis.
$ grep dolor lorem_ipsum.dat
Lorem ipsum dolor sit amet, consectetur adipiscing elit.
Lorem ipsum dolor sit amet, consectetur adipiscing elit.
$ awk '/dolor/' lorem_ipsum.dat
Lorem ipsum dolor sit amet, consectetur adipiscing elit.
Lorem ipsum dolor sit amet, consectetur adipiscing elit.

👉 Note: If the action is not given the default action is to print the record that matches the given pattern.

But... how can we find out the first and last word of each line?

Of course grep can, but needs two steps:

$ grep -Eo '^[^ ]+' lorem_ipsum.dat 
Lorem
Maecenas
Nunc
Curabitur
Lorem
Aliquam
$ grep -Eo '[^ ]+$' lorem_ipsum.dat 
elit.
condimentum.
ex.
tellus.
elit.
ultrices.

Let's see awk in action here:

$ awk '{print $1,$NF}' lorem_ipsum.dat 
Lorem elit.
Maecenas condimentum.
Nunc ex.
Curabitur tellus.
Lorem elit.
Aliquam ultrices.

Isn't this better 😎? Yeah, but... HTF does this works?

awk divides the input for your program into Records and Fields.

Records

Records are separated by a character called the record separator RS. By default, the record separator is the unix newline character \n.

This is why records are, by default, single lines.

Additionally awk has ORS Output Record Separator to control the way records are presented to the stdout.

RS and ORS should be enclosed in quotation marks, which indicate a string constant.

To use a different character or a regex simply assign it to the RS or / and ORS variables:

  • Often, the right time to do this is at the beginning of execution BEGIN, before any input is processed, so that the very first record is read with the proper separator.
  • Another way to change the record separator is on the command line, using the variable-assignment feature.

Examples:

$ awk 'BEGIN{RS=" *, *";ORS="<<<---\n"}
       {print $0}' lorem_ipsum.dat 
Lorem ipsum dolor sit amet<<<---
consectetur adipiscing elit.
Maecenas pellentesque erat vel tortor consectetur condimentum.
Nunc enim orci<<<---
euismod id nisi eget<<<---
interdum cursus ex.
Curabitur a dapibus tellus.
Lorem ipsum dolor sit amet<<<---
consectetur adipiscing elit.
Aliquam interdum mauris volutpat nisl placerat<<<---
et facilisis neque ultrices.
<<<---
$ awk '{print $0}' RS=" *, *" ORS="<<<---\n" lorem_ipsum.dat 
Lorem ipsum dolor sit amet<<<---
consectetur adipiscing elit.
Maecenas pellentesque erat vel tortor consectetur condimentum.
Nunc enim orci<<<---
euismod id nisi eget<<<---
interdum cursus ex.
Curabitur a dapibus tellus.
Lorem ipsum dolor sit amet<<<---
consectetur adipiscing elit.
Aliquam interdum mauris volutpat nisl placerat<<<---
et facilisis neque ultrices.
<<<---

Fields

awk records are automatically parsed or separated into chunks called fields.

By default, fields are separated by whitespace (any string of one or more spaces, TABs, or newlines), like words in a line.

To refer to a field in an awk program, you use a dollar $ sign followed by the number of the field you want.

Thus, $1 refers to the first field, $2 to the second, and so on.

👉 IMPORTANT: $0 represents the whole input record.

$ awk '{print $3}' lorem_ipsum.dat 
dolor
erat
orci,
dapibus
dolor
mauris

NF is a predefined variable it's value is the number of fields in the current record. So, $NF will be always the last field of the record.

$ awk '{print NF}' lorem_ipsum.dat 
8
7
10
4
8
10

vs.

$ awk '{print $NF}' lorem_ipsum.dat
elit.
condimentum.
ex.
tellus.
elit.
facilisis.

FS holds the valued of the field separator, this value is a single-character string or a regex that matches the separations between fields in an input record.

The default value is " ", a string consisting of a single space. As a special exception, this value means that any sequence of spaces, TABs, and/or newlines is a single separator.

In the same fashion that ORS we have a OFS variable to manage how our fields are going to be send to the output stream.

$ cat /etc/group
nobody:*:-2:
nogroup:*:-1:
wheel:*:0:root
daemon:*:1:root
kmem:*:2:root
sys:*:3:root
tty:*:4:root
$ awk '!/^(_|#)/&&$1=$1' FS=":" OFS="<->" /etc/group
nobody<->*<->-2<->
nogroup<->*<->-1<->
wheel<->*<->0<->root
daemon<->*<->1<->root
kmem<->*<->2<->root
sys<->*<->3<->root
tty<->*<->4<->root

Note: Ummm ... $1=$1 ????3


Keeping records and fields in mind, were now ready to understand our previous code:

$ awk '{print $1,$NF}' lorem_ipsum.dat 
Lorem elit.
Maecenas condimentum.
Nunc ex.
Curabitur tellus.
Lorem elit.
Aliquam ultrices.

NR and FNR

These are two useful built-in variables:

NR : number of input records awk has processed since the beginning of the program’s execution.

FNR : current record number in the current file, awk resets FNR to zero each time it starts a new input file.

$ cat n1.dat 
one
two
$ cat n2.dat 
three
four
$ awk '{print NR,FNR,$0}' n1.dat n2.dat 
1 1 one
2 2 two
3 1 three
4 2 four

Fancier Printing

The format string is very similar to that in the ISO C.

Syntax:

printf format, item1, item2, …

$ awk '{printf "%20s <-> %s\n",$1,$NF}' lorem_ipsum.dat 
               Lorem <-> elit.
            Maecenas <-> condimentum.
                Nunc <-> ex.
           Curabitur <-> tellus.
               Lorem <-> elit.
             Aliquam <-> ultrices.

Redirecting Output

Output from print and printf is directed to the standard output by default but we can use redirection to change the destination.

Redirections in awk are written just like redirections in shell commands, except that they are written inside the awk program.

$ awk 'BEGIN{print "hello">"hello.dat"}'
$ awk 'BEGIN{print "world!">>"hello.dat"}'
$ cat hello.dat 
hello
world!

It is also possible to send output to another program through a PIPE:

$ awk 'BEGIN{sh="/bin/sh";print "date"|sh;close(sh)}'
dom nov 13 18:36:25 CET 2016

The [streams] can be pointed to the stdin, the stdout and the stderr.

For example, we can write an error message to the stderr like this:

$ awk 'BEGIN{print "Serious error detected!" > "/dev/stderr"}'
Serious error detected!

Working with arrays

In awk the arrays are associative, each one is a collection of pairs, indexvalue, where the any number or string can be an index.

No declaration is needed; new pairs can be added at any time.

Index Value
"perro" "dog"
"gato" "cat"
"uno" "one"
1 "one"
2 "two"

To refer an array:

array[index-expression]

To assign values:

array[index-expression] = value

To check if a key is indexed:

indx in array

To iterate it:

for (var in array) {
    var, array[var]
    }

Using numeric values as indexes and preserving the order:

for (i = 1; i <= max_index; i++) {
    print array[i]
    }

A complete example:

$ cat dict.dat
uno one
dos two
tres three
cuatro four
awk '{dict[$1]=$2}
     END{if ("uno" in dict)
           print "Yes we have uno in dict!"
         if (!("cinco" in dict))
           print "No , cinco is not in dict!"
         for (esp in dict){
            print esp, "->" ,dict[esp]
            }
     }'  dict.dat

Gives you:

Yes we have uno in dict!
No , cinco is not in dict!
uno -> one
dos -> two
tres -> three
cuatro -> four

gawk does not sort arrays by default:

awk 'BEGIN{
      a[4]="four"
      a[1]="one"
      a[3]="three"
      a[2]="two"
      a[0]="zero"
      exit
      }
      END{for (idx in a){
             print idx, a[idx]
             }
      }'
4 four
0 zero
1 one
2 two
3 three

But you can take advantage of [PROCINFO] for sorting:

awk 'BEGIN{
      PROCINFO["sorted_in"] = "@ind_num_asc"
      a[4]="four"
      a[1]="one"
      a[3]="three"
      a[2]="two"
      a[0]="zero"
      exit
      }
      END{for (idx in a){
             print idx, a[idx]
             }
      }'
0 zero
1 one
2 two
3 three
4 four

Build-in functions

gensub(regexp, replacement, how [, target]) : Is the most advanced function for string replacing.

And their simpler alternatives:

gsub(regexp, replacement [, target])

sub(regexp, replacement [, target])

Having this file:

$ cat lorem.dat
Lorem ipsum dolor sit amet, consectetur adipiscing elit.
Maecenas pellentesque erat vel tortor consectetur condimentum.
Nunc enim orci, euismod id nisi eget, interdum cursus ex.
Curabitur a dapibus tellus.
Lorem ipsum dolor sit amet, consectetur adipiscing elit.
Aliquam interdum mauris volutpat nisl placerat, et facilisis.

We're going to swap the position of the words placed at the left and the right of each comma.

$ awk '{print gensub(/([^ ]+)( *, *)([^ ]+)/,
                     "\\3\\2\\1", "g")}' lorem.dat
Lorem ipsum dolor sit consectetur, amet adipiscing elit.
Maecenas pellentesque erat vel tortor consectetur condimentum.
Nunc enim euismod, orci id nisi interdum, eget cursus ex.
Curabitur a dapibus tellus.
Lorem ipsum dolor sit consectetur, amet adipiscing elit.
Aliquam interdum mauris volutpat nisl et, placerat facilisis.

Using gensub we capture three groups and then we swap the order.

To illustrate a simpler action let's change dots for commas:

awk '$0=gensub(/\./, ",", "g")' lorem.dat
Lorem ipsum dolor sit amet, consectetur adipiscing elit,
Maecenas pellentesque erat vel tortor consectetur condimentum,
Nunc enim orci, euismod id nisi eget, interdum cursus ex,
Curabitur a dapibus tellus,
Lorem ipsum dolor sit amet, consectetur adipiscing elit,
Aliquam interdum mauris volutpat nisl placerat, et facilisis,

Using gsub alternative:

awk 'gsub(/\./, ",")' lorem.dat
Lorem ipsum dolor sit amet, consectetur adipiscing elit,
Maecenas pellentesque erat vel tortor consectetur condimentum,
Nunc enim orci, euismod id nisi eget, interdum cursus ex,
Curabitur a dapibus tellus,
Lorem ipsum dolor sit amet, consectetur adipiscing elit,
Aliquam interdum mauris volutpat nisl placerat, et facilisis,

This option seems better when no group capture is needed.

Other interesting functions are index and substr.

index(in, find)

substr(string, start [, length ])

Works like this:

$ awk 'BEGIN{t="hello-world";print index(t, "-")}'
6
$ awk 'BEGIN{t="hello-world";print substr(t,index(t, "-")+1)}'
world

The split function is used to create an array from a string dividing it by a separator char, it returns the number of elements of the created array.

split(string, array [, fieldsep [, seps ] ])

$ cat passwd
jd001:x:1032:666:Javier Diaz:/home/jd001:/bin/rbash
ag002:x:8050:668:Alejandro Gonzalez:/home/ag002:/bin/rbash
jp003:x:1000:666:Jose Perez:/home/jp003:/bin/bash
ms004:x:8051:668:Maria Saenz:/home/ms004:/bin/rbash
rc005:x:6550:668:Rosa Camacho:/home/rc005:/bin/rbash
$ awk 'n=split($0, a, ":"){print n, a[n]}' passwd
7 /bin/rbash
7 /bin/rbash
7 /bin/bash
7 /bin/rbash
7 /bin/rbash

👉 Note: This could be done in a much more simpler way:

$ awk '{print NF,$NF}' FS=':' passwd
7 /bin/rbash
7 /bin/rbash
7 /bin/bash
7 /bin/rbash
7 /bin/rbash

Custom functions

Write a custom function is quite simple:

awk 'function test(m)
     {
        printf "This is a test func, parameter: %s\n", m
     }
     BEGIN{test("param")}'

Give us:

This is a test func, parameter: param

We can also give back an expression using a return statement:

awk 'function test(m)
     {
        return sprintf("This is a test func, parameter: %s", m)
     }
     BEGIN{print test("param")}'

Parsing by parameter is the only way to make a local variable inside a function.

Scalar values are passed by value and arrays by reference, so any change made to an array inside a function will be reflected in the global scope:

 awk 'function test(m)
      {
       m[0] = "new"
      }
      BEGIN{m[0]=1
            test(m)
            exit
      }
      END{print m[0]}'

Outputs:

new

Now let's have some fun :godmode:

Our challenges:

01. Penultimate word of a Record.

02. Replacing a Record.

03. Place a semicolon at the end of each Record.

04. Place a comma between every word.

05. All together?

06. Redirecting odd records to a file and even ones to another.

07. Given a password file get the missing field.

08. Field swapping.

09. Traceroute hacking.

10. Where are my children?

11. Data aggregation.

12. Records between two patterns.

13. Field transformation.

14. Records to columns.

15. FASTA File processing.

16. Complex reporting.

17. Files joiner.

18. Passwd and Group.

19. User connections.

20. Uptime total load average.


01. Penultimate word of a Record

Having this source file:

$ cat lorem.dat
Lorem ipsum dolor sit amet, consectetur adipiscing elit.
Maecenas pellentesque erat vel tortor consectetur condimentum.
Nunc enim orci, euismod id nisi eget, interdum cursus ex.
Curabitur a dapibus tellus.
Lorem ipsum dolor sit amet, consectetur adipiscing elit.
Aliquam interdum mauris volutpat nisl placerat, et facilisis.
$ awk '{print $(NF-1)}' lorem.dat
adipiscing
consectetur
cursus
dapibus
adipiscing
neque

Not too much to explain here, NF stores the number of fields in the current record, so NF-1 points to field before last and $(NF-1) will be its value.


02. Replacing a record

Our task, file record substitution, the third line must become:

This not latin

Nothing more simple, just play around NR (number of record).

Code:

$ awk 'NR==3{print "This is not latin";next}{print}' lorem.dat
Lorem ipsum dolor sit amet, consectetur adipiscing elit.
Maecenas pellentesque erat vel tortor consectetur condimentum.
This is not latin
Curabitur a dapibus tellus.
Lorem ipsum dolor sit amet, consectetur adipiscing elit.
Aliquam interdum mauris volutpat nisl placerat, et facilisis.

Alternative solution to avoid next statement: assign the new line to the complete record $0.

Example:

$ awk 'NR==3{$0="This is not latin"}1' lorem.dat
Lorem ipsum dolor sit amet, consectetur adipiscing elit.
Maecenas pellentesque erat vel tortor consectetur condimentum.
This is not latin
Curabitur a dapibus tellus.
Lorem ipsum dolor sit amet, consectetur adipiscing elit.
Aliquam interdum mauris volutpat nisl placerat, et facilisis.

03. Place a semicolon at the end of each record

$ awk '1' ORS=";\n" lorem.dat
Lorem ipsum dolor sit amet, consectetur adipiscing elit.;
Maecenas pellentesque erat vel tortor consectetur condimentum.;
Nunc enim orci, euismod id nisi eget, interdum cursus ex.;
Curabitur a dapibus tellus.;
Lorem ipsum dolor sit amet, consectetur adipiscing elit.;
Aliquam interdum mauris volutpat nisl placerat, et facilisis neque ultrices.;

As the default RS is the unix break line \n we just need to prefix the semicolon to the Output Record Separator OFS.

⚠️ ATENCION: What about that strange 1?4


04. Place a comma between every word

$ awk '{$1=$1}1' OFS=',' lorem.dat
Lorem,ipsum,dolor,sit,amet,,consectetur,adipiscing,elit.
Maecenas,pellentesque,erat,vel,tortor,consectetur,condimentum.
Nunc,enim,orci,,euismod,id,nisi,eget,,interdum,cursus,ex.
Curabitur,a,dapibus,tellus.
Lorem,ipsum,dolor,sit,amet,,consectetur,adipiscing,elit.
Aliquam,interdum,mauris,volutpat,nisl,placerat,,et,facilisis,neque,ultrices.

The most significant part of this code is how it forces a record reconstruction with $1=$1 for the current value of the OFS.


05. All together?

$ awk '{$1=$1}1' OFS=',' ORS=';\n' lorem.dat
Lorem,ipsum,dolor,sit,amet,,consectetur,adipiscing,elit.;
Maecenas,pellentesque,erat,vel,tortor,consectetur,condimentum.;
Nunc,enim,orci,,euismod,id,nisi,eget,,interdum,cursus,ex.;
Curabitur,a,dapibus,tellus.;
Lorem,ipsum,dolor,sit,amet,,consectetur,adipiscing,elit.;
Aliquam,interdum,mauris,volutpat,nisl,placerat,,et,facilisis,neque,ultrices.;

As simply as playing with output vars: OFS and ORS.


06. Redirecting odd records to a file and even ones to another

Let's start with the final solution:

$ awk 'NR%2{print > "even.dat";next}
           {print > "odd.dat"}' lorem.dat
$ cat even.dat
Lorem ipsum dolor sit amet, consectetur adipiscing elit.
Nunc enim orci, euismod id nisi eget, interdum cursus ex.
Lorem ipsum dolor sit amet, consectetur adipiscing elit
$ cat odd.dat
Maecenas pellentesque erat vel tortor consectetur condimentum.
Curabitur a dapibus tellus.
Aliquam interdum mauris volutpat nisl placerat, et facilisis.

The [modulo] function (%) finds the remainder after division for the current Record Number NR divided by two:

$ awk '{print NR%2}' lorem.dat
1
0
1
0
1
0

As far as we now yet, in awk 1 is True and 0 False. We redirect our output evaluating this fact.

next requires an special attention, it forces awk to immediately stop the current record process and pass to next one.

In this way we elude a double condition that would look like this:

awk  'NR % 2{print > "even.dat"}
     !NR % 2{print > "odd.dat"}' lorem.dat

07. Given a password file get the missing field

$ cat /etc/passwd
jd001:x:1032:666:Javier Diaz::/bin/rbash
ag002:x:8050:668:Alejandro Gonzalez::/bin/rbash
jp003:x:1000:666:Jose Perez::/bin/bash
ms004:x:8051:668:Maria Saenz::/bin/rbash
rc005:x:6550:668:Rosa Camacho::/bin/rbash

Let's assume the home directory by prefixing the fixed string "/home/" to the username:

$ awk '$6="/home/"$1' FS=':' OFS=':' /etc/passwd
jd001:x:1032:666:Javier Diaz:/home/jd001:/bin/rbash
ag002:x:8050:668:Alejandro Gonzalez:/home/ag002:/bin/rbash
jp003:x:1000:666:Jose Perez:/home/jp003:/bin/bash
ms004:x:8051:668:Maria Saenz:/home/ms004:/bin/rbash
rc005:x:6550:668:Rosa Camacho:/home/rc005:/bin/rbash

Our first step should be considering the field separator, a colon, for input as well as for output.

Then we need to find the void field position, 6 for this example.

Finally, we compose the required value using the given string and the user login stored in the first field.

⚠️ IMPORTANT: print is not needed because $6 assignation return value will always be True and awk default action is to print the affected record.


08. Field swapping

Our goal: last field should become first and first become last.

Final code:

$ awk -F\: '{last=$1;$1=$NF;$NF=last}1' FS=":" OFS=':' /etc/passwd
/bin/rbash:x:1032:666:Javier Diaz:/home/jd001:jd001
/bin/rbash:x:8050:668:Alejandro Gonzalez:/home/ag002:ag002
/bin/bash:x:1000:666:Jose Perez:/home/jp003:jp003
/bin/rbash:x:8051:668:Maria Saenz:/home/ms004:ms004
/bin/rbash:x:6550:668:Rosa Camacho:/home/rc005:rc005

We are playing with an intermediate variable used to store the first field value, the we swap its value with the last one, finally we assign last variable to $NF ($NF=last).


09. Traceroute hacking

Having this output:

$  traceroute -q 1 google.com 2>/dev/null
 1  hitronhub.home (192.168.1.1)  5.578 ms
 2  217.217.0.1.dyn.user.ono.com (217.217.0.1)  9.732 ms
 3  10.127.54.181 (10.127.54.181)  10.198 ms
 4  62.42.228.62.static.user.ono.com (62.42.228.62)  35.519 ms
 5  72.14.235.20 (72.14.235.20)  26.003 ms
 6  216.239.50.133 (216.239.50.133)  25.678 ms
 7  mad01s24-in-f14.1e100.net (216.58.211.238)  25.019 ms

We need to compute the package travelling total time.

$ traceroute -q 1 google.com 2>/dev/null|\
  awk '{total+=$(NF-1)}
       END{print "Total ms: "total}'
Total ms: 153.424

Because no condition is specified, the action is executed for all records.

total+=$(NF-1): total variable is used to accumulate the value of each Record penultimate Field $(NF-1).

Finally, we use the END rule to show the final total value.


10. Where are my children?

Our job: get our shell dependent processes.

$ echo $$
51026

First thing: Launch the background processes.

$ sleep 10 & sleep 15 & sleep 20 &
[1] 86751
[2] 86752
[3] 86753

Using ps utility, awk will look for the third field known as the PPID.

👉 Note: We're using -v to set ppid var before execution of the program begins.

$ ps -ef|awk -v ppid=$$ '$3==ppid'
  501 86751 51026   0  7:57PM ttys001    0:00.00 sleep 10
  501 86752 51026   0  7:57PM ttys001    0:00.00 sleep 15
  501 86753 51026   0  7:57PM ttys001    0:00.00 sleep 20
    0 86754 51026   0  7:57PM ttys001    0:00.00 ps -ef
  501 86755 51026   0  7:57PM ttys001    0:00.00 awk $3==51026

We just need the sleeps:

$ ps -ef|awk -v ppid=$$ '$3 == ppid && /slee[p]/ 
                         {print $2" -> "$5}'
86751 -> 7:57PM
86752 -> 7:57PM
86753 -> 7:57PM

The solution needs a new condition to add: find the sleep pattern in our current record /slee[p]/.

The triggered action will be to print the second field $2 with stands for the PID and the fifth $5, the time stamp.


11. Data aggregation

Having this file:

$ cat ips.dat
IP            BYTES
81.220.49.127 328
81.220.49.127 328
81.220.49.127 329
81.220.49.127 367
81.220.49.127 5302
81.226.10.238 328
81.227.128.93 84700

Our task is to compute how many bytes per IP are processed.

$ awk 'NR>1{ips[$1]+=$2}
       END{for (ip in ips){print ip, ips[ip]}}' ips.dat
81.220.49.127 6654
81.227.128.93 84700
81.226.10.238 328

Bunch of things here to explain.

NR>1{ips[$1]+=$2}: The action ips[$1]+=$2 is only executed when the current record number is greater than one NR>1. This is needed to avoid the header.

ips is an array indexed by the ip value (the $1 field), for each key we are going to accumulate in the value of the second field.

Take notice of an important fact, if a key is not present in the array, awk adds a new element to the structure, otherwise is going to update the previous value pointed by that key (as in our example).

The END rule is just used to iterate the array by indexes and values.

This code could be rewritten in complete different manner to avoid the use of arrays and preserve the order taken advantage of the sorted IPs file:

awk 'NR==1{next}
    lip && lip != $1{print lip,sum;sum=0}
    {sum+=$2;lip=$1}
    END{print lip,sum}' ips.dat
81.220.49.127 6654
81.226.10.238 328
81.227.128.93 84700

NR==1{next}: Bypass the header.

lip && lip != $1{print lip,sum;sum=0}: Here we use a var named lip (last-ip). lip && lip != $1 When lip is not null and it's value not equal to the first field (that holds the current ip) the triggered action will be to print lip and sum the total amount of bytes for the last IP. Then we initialize it sum=0.

The trick is clear, every time IP ($1) changes we show the stats of the previous one.

{sum+=$2;lip=$1}: To update the bytes counter sum+=$2 and assign the current IP to lip: lip=$1. It is the last step of our record processing.

The END block is used to print the pending values.

This code preserves the order, but in my opinion, this comes at the expense of significantly increased complexity.


12. Records between two patterns

Our task is two extract the lines between and OUTPUT and END.

$ cat pat.dat
test -3
test -2
test -1
OUTPUT
top 2
bottom 1
left 0
right 0
page 66
END
test 1
test 2
test 3

This is a classic example used to illustrate how pattern matching works in awk and its associate actions which I dedicated a complete [post].

$ awk '/END/{flag=0}flag;/OUTPUT/{flag=1}' pat.dat
top 2
bottom 1
left 0
right 0
page 66

Its based in the flag variable value, it will be True (1) when the starting pattern OUTPUT is found and False (0) when END tag is reached.

To avoid an additional step, the action order is very important, if we follow the logic sequence:

$ awk '/OUTPUT/{flag=1}flag;/END/{flag=0}' pat.dat
OUTPUT
top 2
bottom 1
left 0
right 0
page 66
END

Pattern tags are shown through the output.

The reason: after OUTPUT pattern is found the flag gets activated, as the next action depends of this flag the record is printed.

We can avoid this behavior placing the flag activation as the last step of the flow.


13. Field transformation

Let's suppose this file:

$ cat space.dat
10.80 kb
60.08 kb
35.40 kb
2.20 MB
1.10 MB
40.80 kb
3.15 MB
20.50 kb

Our job will be to calculate our records total weight in mega bytes:

$ awk '{total+= $1 / ($2=="kb" ? 1024: 1)}
       END{print total}'  space.dat
6.61365

To understand how it works one concept must be clear, the [ternary] operator (subject of an old post).

total will be used to accumulate the divison of the first field $1 by the second $2 that will hold the value given by the ternary operator: 1024 when $2 is equal to kb and 1 if no transformation needed.

Finally, we print total value in the END block.


14. Records to columns

Original source:

$ cat group.dat
string1
string2
string3
string4
string5
string6
string8

Our mission is to group records in blocks of three columns like this:

string1 string2 string3
string4 string5 string6
string8

It may seem complex, but becomes much simpler If we understand how to use the Output Field Separator OFS:

$ awk 'ORS = NR%3 ? FS : RS; END{print "\n"}' group.dat
string1 string2 string3
string4 string5 string6
string8

If we set the ORS to a blank character, the FS default value, all the output will become a single line:

$ awk 'ORS=FS; END{print "\n"}' group.dat
string1 string2 string3 string4 string5 string6 string7

ORS = NR%3 ? FS : RS: Finally we use the ternary operator (explained just before) to evaluate the [modulo] NR%3 result of the division of the current field number NR by three.

If the remainder is True the ORS becomes FS, a blank space, otherwise the RS default value will be assigned, the Unix line break \n.


15. FASTA File processing

In bioinformatics, [FASTA] is a text-based file format.

Having the following example:

$ cat fasta.dat
>header1
CGCTCTCTCCATCTCTCTACCCTCTCCCTCTCTCTCGGATAGCTAGCTCTTCTTCCTCCT
TCCTCCGTTTGGATCAGACGAGAGGGTATGTAGTGGTGCACCACGAGTTGGTGAAGC
>header2
GGT
>header3
TTATGAT

We need the total length of each sequence, and a final resume.

Should look like this:

>header1
117
>header2
3
>header3
7
3 sequences, total length 127

awk is the perfect tool for this reporting effort, for this example we will use:

awk '/^>/ { if (seqlen) {
              print seqlen
              }
            print

            seqtotal+=seqlen
            seqlen=0
            seq+=1
            next
            }
    {
    seqlen += length($0)
    }
    END{print seqlen
        print seq" sequences, total length " seqtotal+seqlen
    }' fasta.dat

The first action is tied to the header detection /^>/, that's because all headers stars with > character.

When seqlen is not null its value, that holds the previous sequence length, is printed to the stdout attached to the new header. seqtotal is updated and seqlen initialized to serve the next sequence. Finally, we break further record processing with next.

The second action {seqlen += length($0)} is used to update seqlen summing the total record length.

The END rule purpose is to show the unprinted sequence and the totals.

Trick here is to print the previous sequence length when we found a new header.

When we process the first record seqlen has no value so we skip the visualization.


16. Complex reporting

Source:

$ cat report.dat
       snaps1:          Counter:             4966
        Opens:          Counter:           357283

     Instance:     s.1.aps.userDatabase.mount275668.attributes

       snaps1:          Counter:                0
        Opens:          Counter:           357283

     Instance:     s.1.aps.userDatabase.test.attributes

       snaps1:          Counter:             5660
        Opens:          Counter:            37283

     Instance:     s.1.aps.userDatabase.mount275000.attributes

Our duty: create a report to visualize snaps and instance but only when snap first counter tag is greater than zero.

Expected output:

snaps1: Counter: 4966
Instance: s.1.aps.userDatabase.mount275668.attributes
snaps1: Counter: 5660
Instance: s.1.aps.userDatabase.mount275000.attributes

We are playing again around patterns and flags:

awk '{$1=$1}
     /snaps1/ && $NF>0{print;f=1}
     f &&  /Instance/ {print;f=0}'  report.dat

For every record the first action is executed, it forces awk to rebuild the entire record, using the current values for OFS 3.

This trick allows us to convert a multiple space separator to a single char, the default value for the Output Field Separator.

Let's see this:

$ awk '1' text.dat
one      two
three              four
$ awk '$1=$1' text.dat
one two
three four

Second action is triggered when the pattern is found and the last field greater than zero /snaps1/ && $NF>0.

awk prints the record and assign a True value to the flag print;f=1.

Last step: when flag is True and instance pattern in the line f && /Instance/, show the line and deactivate flag: print;f=0.


17. Files joiner

Let's suppose two archives:

$ cat join1.dat
3.5 22
5. 23
4.2 42
4.5 44
$ cat join2.dat
3.5
3.7
5.
6.5

We need the records from the first one join1.dat when the first fields are in the second one join2.dat.

Output should be:

3.5 22
5. 23

We can use unix join utility, of course, but we need to sort the first file:

$ join <(sort join1.dat) join2.dat
3.5 22
5. 23

Not needed in awk:

$ awk 'NR == FNR{a[$1];next}
       $1 in a'  join2.dat join1.dat

Let's study the filters and the actions:

NR == FNR: Record Number equal to Record File Number means that we're processing the first file parsed to awk: join2.dat.

The pair action a[$1];next will be to add a new void value to the array indexed by the first field. next statement will break the record processing and pass the flow to the next one.

For the second action NR != FNR is applied implicitly and affects only to join1.dat, the second condition is $1 in a that will be True when the first field of join1.dat is an array key.


18. Passwd and Group

These are to unix classics:

$ cat /etc/group
dba:x:001:
netadmin:x:002:
$ cat /etc/passwd
jd001:x:1032:001:Javier Diaz:/home/jd001:/bin/rbash
ag002:x:8050:002:Alejandro Gonzalez:/home/ag002:/bin/rbash
jp003:x:1000:001:Jose Perez:/home/jp003:/bin/bash
ms004:x:8051:002:Maria Saenz:/home/ms004:/bin/rbash
rc005:x:6550:002:Rosa Camacho:/home/rc005:/bin/rbash

Our goal, a report like this:

d001:dba
ag002:netadmin
jp003:dba
ms004:netadmin
rc005:netadmin

We need a multiple file flow as we studied in our last example:

$ awk -F\: 'NR == FNR{g[$3]=$1;next}
            $4 in g{print $1""FS""g[$4]}' /etc/group /etc/passwd

To process /etc/group we repeat the NR == FNR comparison then store the name of the group $1 indexed by its ID $3: g[$3]=$1. Finally, we break further record processing with next.

The second condition will target only /etc/passwd records, when the fourth field $4 (group ID) is present in the array $4 in g, we will print the login and the value pointed by the array indexed by the group id g[$4], so: print $1""FS""g[$4].


19. User connections

Users utility output example:

$ users
negan rick bart klashxx klashxx ironman ironman ironman

We're going to count logons per user.

$ users|awk '{a[$1]++}
             END{for (i in a){print i,a[i]}}' RS=' +'
rick 1
bart 1
ironman 3
negan 1
klashxx 2

The action is performed for all the records.

a[$1]++: This is the counter, for each user $1 it increments the pointed value (uninitialized vars have the numeric value zero).

In the END block iterate the array by key and the stored value to present the results.


20. Uptime total load average

A typical output:

$ uptime
 11:08:51 up 121 days, 13:09, 10 users,  load average: 9.12, 14.85, 20.84

How can we get the total load average mean?

$ uptime |awk '{printf "Load average mean: %0.2f\n", 
                ($(NF-2)+$(NF-1)+$(NF))/3 }' FS='(:|,) +'
Load average mean: 14.94

Here's a new technique.

We’re using a [regex] as the field separator (:|,) +, so the FS can be a colon and a comma followed by zero or more blank spaces.

We just need the last three fields to perform the arithmetic required, then we use printf attached to a proper mask.


⚠️ Disclaimer 2 ⚠️

If you are still here, THANKS!!

From my point of view, awk is an underrated language and needs much love ❤️.

If you’re hungry for more let me know it in the comment section bellow and I will consider a second part to finish my mission ... bore you to death :neckbeard:.

Happy coding!

Footnotes

  1. [A Guide to Unix Shell Quoting][quoting-guide].

  2. [Wikipedia on pipelines][pipes].

  3. There are times when it is convenient to force awk to rebuild the entire record, using the current values of the FS and OFS.

    To do this, we use the seemingly innocuous assignment: $1 = $1 2

  4. Quick answer, It's just a shortcut to avoid using the print statement.

    In awk when a condition gets matched the default action is to print the input line.

    $ echo "test" |awk '1'

    Is equivalent to:

    echo "test"|awk '1==1'

    echo "test"|awk '{if (1==1){print}}'

    That's because 1 will be always [true].

Releases

No releases published

Packages

 
 
 

Contributors

Languages